bglP [2018-07-26 14:06:49]

beta-glucoside permease of the phosphotransferase system, EIIBCA of the PTS, Trigger enzyme, control of LicT activity

Locus: BSU39270

Isoelectric point: 6.81

Molecular weight: 64.52 kDa

Protein length: 609 aa

Gene length: 1827 bp

Function: beta-glucoside uptake and phosphorylation, control of LicT activity

Product: beta-glucoside permease of the phosphotransferase system

Essential: no

E.C.: 2.7.1.69

Synonyms: sytA

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Phosphotransferase system → Sugar specific PTS proteins
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of beta-glucosides
• Information processing → Regulation of gene expression → Transcription factors and their control → Control of PRD-type regulators
• Information processing → Regulation of gene expression → Trigger enzyme → Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on a Cys residue
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 4,033,778 → 4,035,607

The protein

Catalyzed reaction/ biological activity

• Protein EIIA N(pi)-phospho-L-histidine + protein EIIB = protein EIIA + protein EIIB N(pi)-phospho-L-histidine/cysteine (according to Swiss-Prot)

Protein family

• PTS permease, sucrose family PubMed

Paralogous protein(s)

• SacX, SacP, TreP, MurP

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: bglP-bglH-yxiE
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, (CcpA binding site overlaps -35 region) PubMed, in CcpA regulon
  • LicT: anti-termination, via LicT-dependent RNA switch, lack of LicT-dependent antitermination in the presence of gucose due to the requirement of LicT to be phosphorylated by HprK, in LicT regulon

  Regulation

  • induced by salicin (LicT) PubMed

  Additional information

  • An [ncRNA|search|antisense RNA] is predicted for 'bglP' PubMed

Biological materials

Mutant

• GP475 (erm), available in the Stülke lab
• BKE39270 (ΔbglP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTGTATACCTCCTTTTT, downstream forward: _UP4_TGAAAAAACTAATGGGGTGA
• BKK39270 (ΔbglP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTGTATACCTCCTTTTT, downstream forward: _UP4_TGAAAAAACTAATGGGGTGA

Expression vector

• pGP1290 (C-terminal Strep-tag, purification from B. subtilis, for SPINE, in pGP382), available in Stülke lab,
• pGP1300 (expression of bglP in B. subtilis, in pBQ200), available in Stülke lab

LacZ fusion

• pGP600 (in pAC6), available in Stülke lab

References

Loading